The short version of prohibited list fits in a sentence. The long version — which is the one that helps — is below.
Reviewed 2026-08-01. Anything still debated is marked as such rather than presented as settled.
TB-500 is a short synthetic peptide sold under a trade name rather than a systematic chemical name. Suppliers usually describe it as a fragment of thymosin beta-4 and ship it as a lyophilised powder intended for laboratory use. Because the label is commercial, the exact sequence attributed to it is not fully consistent across catalogues, and some listings present a seven-residue peptide while others describe related fragments of similar length. It is not an approved medicine in any major jurisdiction, and it is handled as a research chemical.
Thymosin beta-4 itself is a natural peptide of 43 residues found in many cell types and body fluids. Its best-characterised function is binding and sequestering actin monomers, which influences cytoskeletal dynamics. The sequence most often associated with TB-500, LKKTETQ, corresponds to part of that actin-binding region. A different fragment, Ac-SDKP, is also derived from the same parent peptide and is studied in its own right, which is one reason discussions of thymosin fragments can become confusing. The two are structurally distinct and are not interchangeable.
Purity and identity are separate measurements and are often confused. Reverse-phase high-performance liquid chromatography, usually with ultraviolet detection near 214 nanometres, reports the share of total peak area belonging to the target compound. Mass spectrometry by electrospray or matrix-assisted laser desorption then checks whether the observed mass matches the expected sequence. Neither measurement alone shows that a vial holds the intended peptide. Peptide content, meaning the fraction of vial mass that is genuine peptide rather than counter-ion, water or residual acid, is reported separately and is frequently lower than the stated purity figure.
The regulatory position is broadly consistent across major jurisdictions: no thymosin beta-4 fragment is an approved medicine, and laboratory material is commonly labelled as not intended for human consumption. Anti-doping rules in sport list thymosin beta-4 and its fragments among prohibited peptide hormones. Because these products travel through research-chemical channels rather than pharmaceutical supply chains, quality varies considerably between vendors. Independent testing of identity, purity and sterility is the only dependable check, and a certificate of analysis describes one batch rather than a supplier's whole catalogue.
Lyophilized peptide powder is normally held desiccated at −20 °C, with −80 °C used for longer storage periods. Allowing a sealed vial to reach room temperature before opening is standard practice, because condensation forming on cold powder introduces moisture. Once dissolved, solutions are typically kept cold and shielded from light. Repeated freeze-thaw cycles are avoided because they encourage aggregation and gradual loss of material. These conventions are general to synthetic peptides rather than unique to any one sequence.
| Property | Value | Notes |
|---|---|---|
| Name type | Commercial trade name | Not a systematic chemical identifier |
| Parent peptide | Thymosin beta-4 | 43-residue natural peptide |
| Common fragment sequence | LKKTETQ | Maps to part of the actin-binding region |
| Molecular size class | Roughly 0.8-1.0 kDa | Depends on exact fragment and terminal modification |
| Regulatory status | Prohibited in sport | Grouped with peptide hormones in many frameworks |
Research interest in thymosin beta-4 fragments centres on actin sequestration, cell migration and tissue repair models. Most published work uses cultured cells or animal wound and cardiac preparations, and findings are generally described as preliminary. No fragment of this protein has been approved as a therapeutic product by major regulators. Reviews of the field note inconsistent dosing, delivery routes and outcome measures across studies, which complicates direct comparison. The material is best understood as a laboratory reagent with an active but unresolved research literature.
TB-500 is a catalogue name applied to a synthetic peptide related to thymosin beta-4, an actin-binding protein found in most mammalian cells. Suppliers do not use the label consistently: some describe it as the full 43-residue protein, others as a short fragment from the actin-binding region, and others as a related tetrapeptide. Because the name is commercial rather than chemical, two products sold under it may not contain the same molecule. This naming ambiguity is the first point to check in any description of the material.
The most frequently cited identity is a seven-residue fragment with the sequence LKKTETQ, taken from the actin-binding domain of the parent protein. A separate molecule, N-acetyl-seryl-aspartyl-lysyl-proline, often shortened to Ac-SDKP, derives from the same protein's N-terminal region and appears in overlapping literature. Reported molecular masses therefore differ between sources, and a mass value on its own does not establish which fragment is present. Confirmation requires a defined sequence rather than a single number.
Dry peptide powder is commonly kept at −20 °C in a desiccated container away from light, a practice that limits moisture uptake and oxidation. Once dissolved, solutions are generally held at 2–8 °C for short periods or frozen at −20 °C or lower for longer storage, with repeated freeze-thaw cycles avoided. Hydrolysis and oxidation are the main degradation routes for peptides in solution, and both accelerate at higher temperature or extreme pH. Published stability data specific to TB-500 are limited, so shelf life should be treated as uncertain.
Identity and purity checks for peptide material typically combine reversed-phase high-performance liquid chromatography with mass measurement, since retention time alone cannot confirm a sequence. Mass measurement verifies the expected molecular mass within instrument tolerance, while chromatographic peak area provides a purity estimate. Anti-doping analysis of urine uses related but more sensitive workflows, sometimes after solid-phase extraction. For research material, batch documentation, certificate content, and independent testing are common points of scrutiny, because supply chains outside pharmaceutical regulation vary widely in the paperwork they provide.
No major regulatory agency has approved TB-500 for therapeutic use, and it holds no pharmacopoeial monograph. The name appears on the World Anti-Doping Agency prohibited list within the class covering peptide hormones, growth factors, and related substances. Detection in doping control relies on mass spectrometric methods applied to urine, often after preparation steps that concentrate the analyte. Discussion of TB-500 therefore clusters in biochemistry, sports medicine, and anti-doping literature rather than in registered clinical trials.
TB-500 is a synthetic peptide preparation marketed under a name derived from thymosin beta-4, a 43-residue actin-binding protein first isolated from thymus tissue. The full-length protein has a reported molecular mass near 4963 Da, while material sold as TB-500 is often described as a fragment containing the actin-binding motif LKKTETQ. Because suppliers use the name inconsistently, published sources sometimes refer to the same label as a fragment, a synthetic copy, or a related analog. This naming ambiguity complicates direct comparison of reports across studies.
Discussion of the compound frequently appears alongside other short peptides described as fragments of larger proteins. That grouping is convenient but can be misleading, because fragment length, charge, and modification state determine how a peptide behaves in solution and in any experimental system. A seven-residue acetylated peptide and a full-length protein differ in mass by roughly an order of magnitude, and they cannot be assumed to share distribution or binding properties. Precision about which molecule is under discussion is the single most useful step when reading such material.
TB-500 is a shorthand label used in supplier catalogs and online discussion for a short synthetic peptide described as a fragment of thymosin beta-4. Most product listings present it as the N-terminally acetylated heptapeptide Ac-LKKTETQ, a sequence corresponding to the actin-binding region of the parent protein. The name is not a formal chemical designation and does not appear in standard nomenclature systems. Because labeling practices vary between vendors, two products sold under the same name may not contain the same molecule, and the stated sequence should be treated as a claim rather than a fixed definition.
== The influence of age: age-structured models == Age has a deep influence on the disease spread rate in a population, especially the contact rate. This rate summarizes the effectiveness of contacts between susceptible and infectious subjects. Taking into account the ages of the epidemic classes
== Awards and honors == 2023- Women's Empowerment Influencer Award Icahn School of Medicine at Mount Sinai 2017 – Elected Fellow of the American Society for Cell Biology 2015 – Senior Leadership Award of the Women in Cell Biology of the American Society for Cell Biology, named the Sandra K. Masur Leadership Award 2008 – Jacobi Medallion, Mount Sinai Alumni Association 2007 – Rosalind Franklin Society Invited Member of Founding Board 2001 Women in Medicine Silver Achievement Award, Association of American Medical Colleges 1997 Outstanding Woman Scientist – Association for Women in Science, Metropolitan New York Chapter 1997 Lew R. Wasserman Merit Award 1996 Outstanding Faculty Achievement Award 1978 Brotherhood Education Award, Conference of Christians and Jews
=== Natural fission chain-reactors on Earth === Criticality in nature is uncommon. At three ore deposits at Oklo in Gabon, sixteen sites (the so-called Oklo Fossil Reactors) have been discovered at which self-sustaining nuclear fission took place approximately 2 billion years ago. French physicist Francis Perrin discovered the Oklo Fossil Reactors in 1972, but it was postulated by Paul Kuroda in 1956. Large-scale natural uranium fission chain reactions, moderated by normal water, had occurred far in the past and would not be possible now. This ancient process was able to use normal water as a moderator only because 2 billion years before the present, natural uranium was richer in the shorter-lived fissile isotope 235U (about 3%), than natural uranium available today (which is only 0.7%, and must be enriched to 3% to be usable in light-water reactors).
In most cells the smooth endoplasmic reticulum (abbreviated SER) is scarce. Instead there are areas where the ER is partly smooth and partly rough: the transitional ER. The transitional ER gets its name because it contains ER exit sites, areas where the transport vesicles, which contain lipids and proteins made in the ER, detach from the ER and start moving to the Golgi apparatus. Specialized cells can have a lot of smooth endoplasmic reticulum and in these cells the smooth ER has many functions. It synthesizes lipids, phospholipids, and steroids. Cells which secrete these products, such as those in the testes, ovaries, and sebaceous glands have an abundance of smooth endoplasmic reticulum. It also carries out the metabolism of carbohydrates, detoxification of natural metabolism products and of alcohol and drugs, attachment of receptors on cell membrane proteins, and steroid metabolism. In muscle cells, it regulates calcium ion concentration. Smooth endoplasmic reticulum is found in a variety of cell types (both animal and plant), and it serves different functions in each. The smooth endoplasmic reticulum also contains the enzyme glucose-6-phosphatase, which converts glucose-6-phosphate to glucose, a step in gluconeogenesis. It is connected to the nuclear envelope and consists of tubules that are located near the cell periphery. These tubes sometimes branch forming a network that is reticular in appearance. In some cells, there are dilated areas like the sacs of rough endoplasmic reticulum.
Sources: en.wikipedia.org
Factors that affect absorption include: The way a drug product is designed and manufactured Its physical and chemical properties Other ingredients it contains The physiologic characteristics of the person taking the drug How the drug is stored Types of absorption in pharmacokinetics include the following: Instantaneous absorption: absorption is nearly immediate. A common example is bolus intravenous injection. Zero-order absorption: rate of absorption is constant. A common example is continuous intravenous infusion. First-order absorption: rate of absorption is proportional to the amount of drug remaining to be absorbed. Representative examples include typical cases of oral administration, subcutaneous injection, and intramuscular injection. Gastrointestinal transit time Flip–flop kinetics Absorption of Drugs
Naturally occurring zirconium (40Zr) is composed of four stable isotopes (one, 94Zr, may in the future be found radioactive), and one very long-lived radioisotope (96Zr), a primordial nuclide that decays via double beta decay with an observed partial half-life of 2.34 × 1019 years; it can also undergo single beta decay, with a partial half-life of [2.27+0.53−0.36 (stat) ± 0.27 (syst)] × 1020 years. The second most stable radioisotope is 93Zr, which has a half-life of 1.61 million years. Thirty other radioisotopes have been observed from 77Zr to 114Zr; all have half-lives less than a day except for 95Zr (64.032 days), 88Zr (83.4 days), and 89Zr (78.36 hours). The most stable of the isomeric states is just 4.16 minutes for 89mZr. Radioactive isotopes above the theoretically stable mass numbers 90–92 decay by electron emission resulting in niobium isotopes, whereas those below by positron emission or electron capture, resulting in yttrium isotopes.
Substituted phenethylamines (or simply phenethylamines) are a chemical class of organic compounds that are based upon the phenethylamine structure; the class is composed of all the derivative compounds of phenethylamine which can be formed by replacing, or substituting, one or more hydrogen atoms in the phenethylamine core structure with substituents. Phenylethylamines are also generally found to be central nervous system stimulants with many also being entactogens/empathogens, and hallucinogens.
== Diagnosis == The tests to verify Sack–Barabas syndrome are biochemical samples such as collagen typing (performed on a skin biopsy sample) or collagen gene mutation testing. There is no cure for Ehlers-Danlos syndrome, so individual problems and symptoms must be evaluated and cared for accordingly.
Source: US Energy Information Administration 1 peak production already passed in this state 2 Canadian statistics are complicated by the fact it is both an importer and exporter of crude oil, and refines large amounts of oil for the U.S. market. It is the leading source of U.S. imports of oil and products, averaging 2,500,000 bbl/d (400,000 m3/d) in August 2007. Total world production/consumption (as of 2005) is approximately 84 million barrels per day (13,400,000 m3/d).
Sources: en.wikipedia.org
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Marxism–Leninism–Maoism–Prachanda Path (Nepali: मालेमावाद र प्रचण्डपथ Mālemāvād ra Prachaṇḍapath; sometimes shortened to Prachanda Path) is the ideological line of the Communist Party of Nepal (Maoist Centre), also known as the CPN (MC). It is considered a development of Marxism–Leninism–Maoism (MLM) and named after the leader of the CPN (MC), Pushpa Kamal Dahal, commonly known as Prachanda. Prachanda Path was proclaimed in 2001. The ideology was partially inspired by the example of the Communist Party of Peru – Shining Path, which refers to its ideological line as Marxism–Leninism–Maoism–Gonzalo Thought. Prachanda Path does not claim to make an ideological break with Marxism, Leninism or Maoism, but rather to be an extension of these ideologies based on the politics of Nepal. The doctrine came into existence after the party determined that the ideologies of Marxism, Leninism and Maoism could no longer be practiced completely as they had been in the past. The party adopted Prachanda Path as they felt it was a suitable ideology based on the reality of Nepalese politics. Militarily and in the context of the 1996–2006 civil war in Nepal, central to the ideology was the achievement of revolution through the control of rural areas and the encirclement of urban settlements. The CPN (MC) was seen to have abandoned Maoism in its decision to merge with the Communist Party of Nepal (Unified Marxist–Leninist) to form the Nepal Communist Party, but this party has since been disestablished and the CPN (MC) reconstituted.
Bacteria and archaea also can use chemiosmosis to generate ATP. Cyanobacteria, green sulfur bacteria, and purple bacteria synthesize ATP by a process called photophosphorylation. These bacteria use the energy of light to create a proton gradient using a photosynthetic electron transport chain. Non-photosynthetic bacteria such as E. coli also contain ATP synthase. In fact, mitochondria and chloroplasts are the product of endosymbiosis and trace back to incorporated prokaryotes. This process is described in the endosymbiotic theory. The origin of the mitochondrion triggered the origin of eukaryotes, and the origin of the plastid the origin of the Archaeplastida, one of the major eukaryotic supergroups.
The human body's immune response to a surgically-implanted foreign object (prosthetic breast, cardiac pacemaker, orthopedic prosthesis) is to biologically isolate the foreign object with a capsule of tightly-woven collagen fibres. Afterwards, the capsular contracture occurs over time when the thickened, collagen-fibre capsule has compressed inwards, against the breast-implant with great mechanical pressure that deforms and breaks the implant, and so disfigures the breast; the causes of capsular contracture include bacterial contamination, shell-rupture of the medical device, leakage of the prosthetic filler-material, and hematoma. The prosthetic-breast implantation surgeries that have a low-rate of capsular contractures include surgical approaches that feature the submuscular emplacement of the breast-implant and the use of breast implants with a textured surface; limited handling of the breast implants before the surgery, limited contact with and handling of the skin of the implant-pocket, and irrigation of the surgical site with antibiotic solutions. To correct a capsular contraction, the plastic surgeon realises an open capsulotomy procedure to loosen and release the collagen-fibre capsule from the implant-pocket, for removal and replacement with a new model of prosthetic breast. Moreover, non-surgical therapies for treating collagen-fibre capsules include massage, external ultrasonic therapy, pharmaceutic therapy with leukotriene pathway inhibitor medications, and Diapulse therapy (Pulsed Electromagnetic Field Therapy, PEMFT).
Sources: en.wikipedia.org
No. Thymosin beta-4 is a 43-residue natural peptide, while TB-500 is a commercial label applied to a short synthetic fragment of it. The two differ in length, sequence coverage and how they are handled in the laboratory.
Published work usually examines actin binding, cell migration and tissue repair endpoints in cell and animal models. Findings are generally described as preliminary, and controlled human data remain limited.
Because TB-500 is a trade name rather than a chemical identifier, different vendors and papers may attach it to different fragment lengths. Checking the stated sequence is the practical way to resolve the ambiguity.
Desiccated storage at −20 °C is conventional, with −80 °C for extended periods. Vials should be warmed to room temperature before opening to prevent condensation on the powder.